3B (NC_012798) Virus Tagged ORF Clone

CAT#: VC100652

Myc-DDK-tagged ORF clone of viral ORF for 3B [Human cosavirus E], codon optimized for human cell expression, YP_002956085

Specifications

Product Data

• Type: Virus Tagged ORF Clone
• Tag: Myc-DDK
• Symbol: 3B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >The Viral ORF clone VC100652 represents NCBI reference of YP_002956085 with codon optimized for human cell expression
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  GACGTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCCCGTATAACGGTCCATCCAAAAAGGACCTGAAAACACTGAAGCTGAAAGCTCAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
  Protein Sequence

  >VC100652 representing YP_002956085
  Red=Cloning sites Green=Tags
  
  MGPYNGPSKKDLKTLKLKAQ
  
  TRTRRLEQKLISEEDLAANDILDYKDDDDKV
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene
• ACCN: NC_012798
• ORF Size: 60 bp
• OTI Disclaimer: The molecular sequence of this clone can be viewed by clicking the "ORF Nucleotide Sequence" link above. This sequence represents the NCBI reference after codon optimization for human cell expression, and retaining the same decuded protein sequence. The stop codon in the native sequence was removed to create the in-frame c-terminal fusion with a Myc-DDK tag.

Reference Data

• RefSeq: NC_012798.1, YP_002956085
• RefSeq ORF: 60
• MW: 2.2 kDa