3B (NC_013114) Virus Tagged ORF Clone

CAT#: VC100712

Myc-DDK-tagged ORF clone of viral ORF for 3B [Human enterovirus 98], codon optimized for human cell expression, YP_003104783

Specifications

Product Data

• Type: Virus Tagged ORF Clone
• Tag: Myc-DDK
• Symbol: 3B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >The Viral ORF clone VC100712 represents NCBI reference of YP_003104783 with codon optimized for human cell expression
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  GACGTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCGCATACTCCGGCATGCCCAATCAGAAACCAAAGGTTCCCACTCTGCGCCAGGCTAAGGTCCAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
  Protein Sequence

  >VC100712 representing YP_003104783
  Red=Cloning sites Green=Tags
  
  MGAYSGMPNQKPKVPTLRQAKVQ
  
  TRTRRLEQKLISEEDLAANDILDYKDDDDKV
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene
• ACCN: NC_013114
• ORF Size: 69 bp
• OTI Disclaimer: The molecular sequence of this clone can be viewed by clicking the "ORF Nucleotide Sequence" link above. This sequence represents the NCBI reference after codon optimization for human cell expression, and retaining the same decuded protein sequence. The stop codon in the native sequence was removed to create the in-frame c-terminal fusion with a Myc-DDK tag.

Reference Data

• RefSeq: NC_013114.1, YP_003104783
• RefSeq ORF: 69
• MW: 2.5 kDa