SARS-CoV-2 ORF6 Gene cDNA Clone (Native Sequence)

CAT#: VC202560

Native cDNA clone for SARS-CoV-2 ORF6 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724394

Specifications

Product Data

• Vector: pUCminusMCS
• E. coli Selection: Ampicillin
• Mammalian Cell Selection: None
• Sequence Data:
  ORF Nucleotide Sequence

  >The Viral ORF clone VC202560 represents NCBI reference of YP_009724394 for cloning vector
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAA
  GTTTCCATTTGGAATCTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAG
  AATAAATATTCTCAATTAGATGAAGAGCAACCAATGGAGATTGATTAA
  
• ACCN: NC_045512
• ORF Size: 186 bp
• OTI Disclaimer: The molecular sequence of this clone can be viewed by clicking the "ORF Nucleotide Sequence" link above. This sequence represents the NCBI reference of original virus gene, that can be used as a DNA template for subcloning, PCR amplification et al.
• OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.

Reference Data

• RefSeq: NC_045512.2, YP_009724394
• RefSeq ORF: 186
• MW: 7.3 kDa