SARS-CoV-2 ORF10 Gene cDNA Clone (Native Sequence)

CAT#: VC202564

Native cDNA clone for SARS-CoV-2 ORF10 protein [Severe acute respiratory syndrome coronavirus 2], YP_009725255

Specifications

Product Data

• Vector: pUCminusMCS
• E. coli Selection: Ampicillin
• Mammalian Cell Selection: None
• Sequence Data:
  ORF Nucleotide Sequence

  >The Viral ORF clone VC202564 represents NCBI reference of YP_009725255 for cloning vector
  Blue=ORF Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTTGTGCAGAATGAATTCT
  CGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAG
  
• ACCN: NC_045512
• ORF Size: 117 bp
• OTI Disclaimer: The molecular sequence of this clone can be viewed by clicking the "ORF Nucleotide Sequence" link above. This sequence represents the NCBI reference of original virus gene, that can be used as a DNA template for subcloning, PCR amplification et al.
• OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.

Reference Data

• RefSeq: NC_045512.2, YP_009725255
• RefSeq ORF: 117
• MW: 4.4 kDa