SARS-CoV-2 ORF7a Gene cDNA Clone (Native Sequence)
CAT#: VC202561
- TrueORF®
Native cDNA clone for SARS-CoV-2 ORF7a protein [Severe acute respiratory syndrome coronavirus 2], YP_009724395
View other clones from "SARS-CoV-2" (40)
Product Images
Specifications
Product Data | |
Vector | pUCminusMCS |
E. coli Selection | Ampicillin |
Mammalian Cell Selection | None |
Sequence Data |
>The Viral ORF clone VC202561 represents NCBI reference of YP_009724395 for cloning vector
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGAGCTTTATCACTACCAAGAGTGT GTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCAATTCACCATTT CATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGAC GGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAA GTTCAAGAACTTTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACA CTCAAAAGAAAGACAGAATGA |
ACCN | NC_045512 |
ORF Size | 366 bp |
OTI Disclaimer | The molecular sequence of this clone can be viewed by clicking the "ORF Nucleotide Sequence" link above. This sequence represents the NCBI reference of original virus gene, that can be used as a DNA template for subcloning, PCR amplification et al. |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Reference Data | |
RefSeq | NC_045512.2, YP_009724395 |
RefSeq ORF | 366 |
MW | 13.7 kDa |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
VC102555 | Myc-DDK-tagged ORF clone for SARS-CoV-2 nucleocapsid phosphoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724397 |
USD 400.00 |
|
VC102556 | Myc-DDK-tagged ORF clone for SARS-CoV-2 surface glycoprotein extracellular domain [Severe acute respiratory syndrome coronavirus 2], YP_009724390 |
USD 1,860.00 |
|
VC102557 | Myc-DDK-tagged ORF clone for SARS-CoV-2 surface glycoprotein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724390 |
USD 1,860.00 |
|
VC102558 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF3a protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724391 |
USD 400.00 |
|
VC102559 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Membrane Glycoprotein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724393 |
USD 400.00 |
|
VC102560 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF6 protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724394 |
USD 400.00 |
|
VC102561 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF7a protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724395 |
USD 400.00 |
|
VC102562 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF8 protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724396 |
USD 400.00 |
|
VC102563 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Nucleocapsid Phosphoprotein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724397 |
USD 400.00 |
|
VC102564 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF10 protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009725255 |
USD 400.00 |
|
VC102565 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Envelop Protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724392 |
USD 400.00 |
|
VC202557 | Native cDNA clone for SARS-CoV-2 surface glycoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724390 |
USD 1,860.00 |
|
VC202558 | Native cDNA clone for SARS-CoV-2 ORF3a protein [Severe acute respiratory syndrome coronavirus 2], YP_009724391 |
USD 400.00 |
|
VC202559 | Native cDNA clone for SARS-CoV-2 Membrane Glycoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724393 |
USD 400.00 |
|
VC202560 | Native cDNA clone for SARS-CoV-2 ORF6 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724394 |
USD 400.00 |
|
VC202562 | Native cDNA clone for SARS-CoV-2 ORF8 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724396 |
USD 400.00 |
|
VC202563 | Native cDNA clone for SARS-CoV-2 Nucleocapsid Phosphoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724397 |
USD 400.00 |
|
VC202564 | Native cDNA clone for SARS-CoV-2 ORF10 protein [Severe acute respiratory syndrome coronavirus 2], YP_009725255 |
USD 400.00 |
|
VC202565 | Native cDNA clone for SARS-CoV-2 Envelop Protein [Severe acute respiratory syndrome coronavirus 2], YP_009724392 |
USD 400.00 |
|
VC102566 | Myc-DDK-tagged ORF clone for SARS-CoV-2 surface glycoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724390 |
USD 1,860.00 |
|
VC102567 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF3a protein [Severe acute respiratory syndrome coronavirus 2], YP_009724391 |
USD 400.00 |
|
VC102568 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Membrane Glycoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724393 |
USD 400.00 |
|
VC102569 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF6 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724394 |
USD 400.00 |
|
VC102570 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF7a protein [Severe acute respiratory syndrome coronavirus 2], YP_009724395 |
USD 400.00 |
|
VC102571 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF8 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724396 |
USD 400.00 |
|
VC102572 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF10 protein [Severe acute respiratory syndrome coronavirus 2], YP_009725255 |
USD 400.00 |
|
VC102573 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Envelop Protein [Severe acute respiratory syndrome coronavirus 2], YP_009724392 |
USD 400.00 |
|
VC102574 | mRFP-tagged ORF clone for SARS-CoV-2 NSP4 [Severe acute respiratory syndrome coronavirus 2], YP_009725300.1 |
USD 400.00 |
|
VC102575 | mRFP-tagged ORF clone for SARS-CoV-2 NSP5 [Severe acute respiratory syndrome coronavirus 2], YP_009725301.1 |
USD 400.00 |
|
VC102576 | mRFP-tagged ORF clone for SARS-CoV-2 NSP6 [Severe acute respiratory syndrome coronavirus 2], YP_009725302.1 |
USD 400.00 |
|
VC102577 | mRFP-tagged ORF clone for SARS-CoV-2 NSP7 [Severe acute respiratory syndrome coronavirus 2], YP_009725303.1 |
USD 400.00 |
|
VC102578 | mRFP-tagged ORF clone for SARS-CoV-2 NSP8 [Severe acute respiratory syndrome coronavirus 2], YP_009725304.1 |
USD 400.00 |
|
VC102579 | mRFP-tagged ORF clone for SARS-CoV-2 NSP9 [Severe acute respiratory syndrome coronavirus 2], YP_009725305.1 |
USD 400.00 |
|
VC102580 | mRFP-tagged ORF clone for SARS-CoV-2 NSP10 [Severe acute respiratory syndrome coronavirus 2], YP_009725306.1 |
USD 400.00 |
|
VC102581 | mRFP-tagged ORF clone for SARS-CoV-2 NSP14 [Severe acute respiratory syndrome coronavirus 2], YP_009725309.1 |
USD 400.00 |
|
VC102582 | mRFP-tagged ORF clone for SARS-CoV-2 ORF3a [Severe acute respiratory syndrome coronavirus 2], YP_009724391.1 |
USD 400.00 |
|
VC102583 | mRFP-tagged ORF clone for SARS-CoV-2 M protein [Severe acute respiratory syndrome coronavirus 2], YP_009724393.1 |
USD 400.00 |
|
VC102584 | mRFP-tagged ORF clone for SARS-CoV-2 ORF9b [Severe acute respiratory syndrome coronavirus 2], YP_009724397.2 |
USD 400.00 |
|
VC102585 | mRFP-tagged ORF clone for SARS-CoV-2 ORF9c [Severe acute respiratory syndrome coronavirus 2], YP_009724397.2 |
USD 400.00 |
|
VC102586 | mRFP-tagged ORF clone for SARS-CoV-2 ORF10 [Severe acute respiratory syndrome coronavirus 2], YP_009725255.1 |
USD 400.00 |
{0} Product Review(s)
Be the first one to submit a review